Journal: Molecular cancer research : MCR

Article Title: Leptin Signaling Mediates Obesity-associated CSC Enrichment and EMT in Preclinical TNBC Models

doi: 10.1158/1541-7786.MCR-17-0508

Figure Lengend Snippet: CSC/EMT markers are elevated in tumors from DIO mice in association with increased local leptin signaling. (a) Tumor expression of several CSC/EMT-related genes in DIO and control mice identified by RNA sequencing analysis was verified via quantitative RT-PCR. (b) Tumor expression in DIO and control mice of previously established CSC/EMT-related genes (11) not identified by RNA sequencing was measured by quantitative RT-PCR. (c) ALDH activity, another marker of CSC enrichment, was quantified in DIO and control mouse tumors. (d) Immunohistochemical staining for tumor E-cadherin and vimentin expression in DIO and control mice. Representative images shown at x20 magnification. (e) Tumor expression of Lepr as well as mammary fat pad (MFP) expression of Lep in DIO and control mice were measured via quantitative RT-PCR. *P<0.05, **P<0.01

Article Snippet: Cell lines Two mouse mammary tumor cell lines isolated from MMTV-Wnt-1 mice in 2010 by the Hursting laboratory and found to cluster with the basal-like (E-Wnt) and claudin-low (M-Wnt) breast cancer subtypes (11), and human MDA-MB-231 breast cancer cells (ATCC #HTB-26, obtained in 2011), which cluster with the claudin-low subtype, were used in in vitro studies.

Techniques: Expressing, Control, RNA Sequencing, Quantitative RT-PCR, Activity Assay, Marker, Immunohistochemical staining, Staining

Journal: Molecular cancer research : MCR

Article Title: Leptin Signaling Mediates Obesity-associated CSC Enrichment and EMT in Preclinical TNBC Models

doi: 10.1158/1541-7786.MCR-17-0508

Figure Lengend Snippet: Leptin stimulates mammosphere formation in triple-negative mammary tumor cells. Mammosphere formation in (a) E-Wnt, (b) M-Wnt, and (c) MDA-MB-231 cells was assessed at the end of propagation 1 (P1), during which the cells were treated for 7 days with leptin, and following propagation 2 (P2), in which the spheres from P1 were dissociated and then replated with the same treatments for another 7 days. Representative images of mammospheres at the end of P2 are shown at x10 magnification. (d) Lepr expression in parental E-Wnt cells (EWnt-P) as well as E-Wnt cells stably transfected with a scrambled shRNA plasmid (EWnt-S) or shRNA to Lepr (EWnt-L1 and EWnt-L2) was measured by quantitative RT-PCR. (e) Mammosphere formation was assessed in EWnt-P, EWnt-S, EWnt-L1, and EWnt-L2 cells after a 7-day incubation in mammosphere media. Socs3 (f) and Foxc2, Twist2, and Vim (g) gene expression was measured by quantitative RT-PCR. Different letters indicate significant differences, P<0.05.

Article Snippet: Cell lines Two mouse mammary tumor cell lines isolated from MMTV-Wnt-1 mice in 2010 by the Hursting laboratory and found to cluster with the basal-like (E-Wnt) and claudin-low (M-Wnt) breast cancer subtypes (11), and human MDA-MB-231 breast cancer cells (ATCC #HTB-26, obtained in 2011), which cluster with the claudin-low subtype, were used in in vitro studies.

Techniques: Expressing, Stable Transfection, Transfection, shRNA, Plasmid Preparation, Quantitative RT-PCR, Incubation, Gene Expression

Journal: Molecular cancer research : MCR

Article Title: Leptin Signaling Mediates Obesity-associated CSC Enrichment and EMT in Preclinical TNBC Models

doi: 10.1158/1541-7786.MCR-17-0508

Figure Lengend Snippet: Obesity-associated circulating factors promote triple-negative mammary tumor cell viability, migration, invasion, and a CSC/EMT genotype. (a) E-Wnt, M-Wnt, and MDA-MB-231 cell viability following a 48-hour exposure to media containing 2% DIO or control mouse serum was assessed by MTT assay. (b) Migration of E-Wnt, M-Wnt, and MDA-MB-231 cells during a 6-hour exposure to media containing 2% DIO or 2% control mouse serum was measured by wound healing assay. Representative images of cells at baseline and 6 hours are shown at x10 magnification. (c) The invasive capacity of E-Wnt, M-Wnt, and MDA-MB-231 cells in response to chemoattraction with media containing 2% DIO or 2% control mouse serum over 24 hours was measured using Matrigel invasion chambers. Representative images of invading cells are shown at x10 magnification. (d) Expression of CSC/EMT-related genes in E-Wnt, M-Wnt, and MDA-MB-231 cells following a 24-hour exposure to media containing 2% DIO or 2% control mouse serum was measured by quantitative RT-PCR. *P<0.05, **P<0.01, ***P<0.001

Article Snippet: Cell lines Two mouse mammary tumor cell lines isolated from MMTV-Wnt-1 mice in 2010 by the Hursting laboratory and found to cluster with the basal-like (E-Wnt) and claudin-low (M-Wnt) breast cancer subtypes (11), and human MDA-MB-231 breast cancer cells (ATCC #HTB-26, obtained in 2011), which cluster with the claudin-low subtype, were used in in vitro studies.

Techniques: Migration, Control, MTT Assay, Wound Healing Assay, Expressing, Quantitative RT-PCR

Journal: Molecular cancer research : MCR

Article Title: Leptin Signaling Mediates Obesity-associated CSC Enrichment and EMT in Preclinical TNBC Models

doi: 10.1158/1541-7786.MCR-17-0508

Figure Lengend Snippet: Proposed model illustrating leptin-mediated upregulation in CSC/EMT-related genes and phenotype. Our findings suggest that obesity in MMTV-Wnt-1 mice promotes both an excess of leptin production in the tumor microenvironment (normal mammary tissue) and an upregulation in tumor expression of the leptin receptor and CSC/EMT-related genes. They also indicate that leptin signaling promotes a CSC/EMT-related phenotype, including increased CSC enrichment and cell viability, migration, and invasion, and specifically regulates the expression of Foxc2, Twist2, Vim, Akt3, and Sox2 in triple-negative mammary tumor cells. We hypothesize that these genes may mediate the observed leptin-induced CSC/EMT-related phenotype and that leptin regulates these genes via stimulation of the JAK2/STAT3 and/or PI3K/Akt pathways. Black arrows indicate effects observed in this study, solid blue arrows indicate pathways known from the literature, and dotted blue arrows indicate hypothesized mechanisms.

Article Snippet: Cell lines Two mouse mammary tumor cell lines isolated from MMTV-Wnt-1 mice in 2010 by the Hursting laboratory and found to cluster with the basal-like (E-Wnt) and claudin-low (M-Wnt) breast cancer subtypes (11), and human MDA-MB-231 breast cancer cells (ATCC #HTB-26, obtained in 2011), which cluster with the claudin-low subtype, were used in in vitro studies.

Techniques: Expressing, Migration

Journal: Endocrinology

Article Title: The Autophagy Gene Atg16L1 is Necessary for Endometrial Decidualization

doi: 10.1210/endocr/bqz039

Figure Lengend Snippet: List of primers and probes

Article Snippet: Mice were genotyped using RedTaq Polymerase (Sigma) Mix and the gene specific primers listed in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Gene name Species Application, Chemistry Company Sequence/Catalogue number ATG16L1 HM Mouse Genotyping IDT P1: TGGCTGGAGTGCGATCTTCC P2: CAGACGGCAAACGACTGTCCT P3: CAGGATCCTTCTGCACACATTT P4: CACCTGGTTACATTGGCAAACA PR Cre Mouse Genotyping IDT P1: ATG TTT AGC TGG CCC AAA TG P2: TAT ACC GAT CTC CCT GGA CG P3: CCC AAA GAG ACA CCA GGA AG Atg16L1 flox Mouse Genotyping IDT P1: GGAACCACGCTGACATTTGACACTG P2: CAAAGAACAACGAGTGGCAGTAG P3: CATCAGATACACTAGAGCTGG Prp Mouse qPCR, Sybr IDT F: TCC TGG CCA ATA ATG CTG CCA TTG R: AGC AGC CAT TCT CTC CTG TTT GAC 18S Mouse qPCR, Sybr IDT F: TTC CTT ACC TGG TTG ATC CTG CCA R: AGC CAT TCG CAG TTT CAC TGT ACC Wnt4 Mouse qPCR, Taqman ABI Mm01194003_m1 Bmp2 Mouse qPCR, Taqman ABI Mm01340178_m1 Atg16L1 Mouse qPCR, Taqman ABI Mm00513084_m1 18S Mouse qPCR, Taqman ABI 4318839 IGFBP1 Human qPCR, Taqman ABI Hs00236877_m1 PRL Human qPCR, Taqman ABI Hs00168730_m1 Open in a separate window All primer sequences are written 5’ to 3’ Abbreviations: ABI, Applied Biosystems; IDT, integrated DNA technologies; qPCR, quantitative polymerase chain reaction.

Techniques: Sequencing

Journal: Endocrinology

Article Title: The Autophagy Gene Atg16L1 is Necessary for Endometrial Decidualization

doi: 10.1210/endocr/bqz039

Figure Lengend Snippet: Atg16L1 mice have impaired decidualization. A) Dissected uteri, H&E histology, and B) Wet weights of control and Atg16L1 cKO mice that have been stimulated to decidualize (n = 13 Control and n = 11 Atg16L1 cKO). Expression of the decidualization markers C) Bmp2 and D) Wnt4 reveal impaired decidualization in Atg16L1 cKO mice. E) Expression of Atg16L1 in control and Atg16L1 cKO mice following artificial decidualization, (n = 6 Control, 5 Atg16L1 cKO). F) Immunoblotting of LC3B protein on the protein lysate collected from stimulated horn of Control and Atg16L1 cKO mice uteri (n = 3) mice. The GAPDH is used as an internal loading control; *P < 0.05, **P < 0.01, ***P < 0.001. ****P < 0.0001.

Article Snippet: Mice were genotyped using RedTaq Polymerase (Sigma) Mix and the gene specific primers listed in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Gene name Species Application, Chemistry Company Sequence/Catalogue number ATG16L1 HM Mouse Genotyping IDT P1: TGGCTGGAGTGCGATCTTCC P2: CAGACGGCAAACGACTGTCCT P3: CAGGATCCTTCTGCACACATTT P4: CACCTGGTTACATTGGCAAACA PR Cre Mouse Genotyping IDT P1: ATG TTT AGC TGG CCC AAA TG P2: TAT ACC GAT CTC CCT GGA CG P3: CCC AAA GAG ACA CCA GGA AG Atg16L1 flox Mouse Genotyping IDT P1: GGAACCACGCTGACATTTGACACTG P2: CAAAGAACAACGAGTGGCAGTAG P3: CATCAGATACACTAGAGCTGG Prp Mouse qPCR, Sybr IDT F: TCC TGG CCA ATA ATG CTG CCA TTG R: AGC AGC CAT TCT CTC CTG TTT GAC 18S Mouse qPCR, Sybr IDT F: TTC CTT ACC TGG TTG ATC CTG CCA R: AGC CAT TCG CAG TTT CAC TGT ACC Wnt4 Mouse qPCR, Taqman ABI Mm01194003_m1 Bmp2 Mouse qPCR, Taqman ABI Mm01340178_m1 Atg16L1 Mouse qPCR, Taqman ABI Mm00513084_m1 18S Mouse qPCR, Taqman ABI 4318839 IGFBP1 Human qPCR, Taqman ABI Hs00236877_m1 PRL Human qPCR, Taqman ABI Hs00168730_m1 Open in a separate window All primer sequences are written 5’ to 3’ Abbreviations: ABI, Applied Biosystems; IDT, integrated DNA technologies; qPCR, quantitative polymerase chain reaction.

Techniques: Control, Expressing, Western Blot